A critical role for IL-12 in CCR5 induction on T cell receptor-triggered mouse CD4⁺ and CD8⁺ T cells

2.1 CCR5 mRNA expression is induced in TCR-stimulated T cells depending on the exposure to IL-12

We investigated whether CCR5 is expressed on resting or TCR-stimulated T cells and if not, what type of stimulation is responsible for the induction of this chemokine receptor. Purified T cells were prepared from normal BALB/c lymph node cells and stimulated in vitro with immobilized anti-CD3 plus soluble anti-CD28 mAb for 48 h. Total RNA was isolated from these activated T cells as well as from unstimulated resting (freshly prepared) T cells and assayed for mRNA expression of CCR5 (Fig. 1A). The mRNA of CCR5 was hardly detected in resting T cells and only marginally expressed by anti-CD3/anti-CD28-activated T cells.

We next examined whether IL-12, the cytokine capable of promoting Th1 differentiation can up-regulate CCR5 mRNA induction. As shown in Fig. 1B, the expression of IL-12 receptor (IL-12R) β1 and β2 components was up-regulated in anti-CD3/anti-CD28-activated T cells. Stimulation of these activated T cells with IL-12 resulted in striking enhancement of CCR5 mRNA expression (Fig. 2A). This contrasted with the failure of exogenous rIL-2 to induce CCR5 up-regulation, i.e. the level of CCR5 mRNA after exposure to rIL-2 was comparable to that in a cytokine-unstimulated control group. Fig. 2B shows the time course of CCR5 mRNA induction. IL-12 induced the up-regulation of CCR5 mRNA expression in a time-dependent manner from 12 to 36 h after stimulation. IL-2 again failed to up-regulate throughout the entire culture period examined.

To determine whether endogenous IL-12 derived from APC can induce CCR5 on TCR-stimulated T cells, a B cell-depleted splenic fraction (T+APC) instead of purified T cells was stimulated with anti-CD3 plus anti-CD28 in the presence of anti-IL-12 neutralizing mAb or control IgG. As shown in Fig. 3A, CCR5 expression in cultures containing anti-CD3/anti-CD28 was slightly up-regulated in the absence of anti-IL-12 mAb (in the presence of control rat Ig) when compared with a group of purified T cells alone. This CCR5 up-regulation was inhibited in the presence of anti-IL-12 mAb. The levels of CCR5 mRNA expression induced by a T+APC fraction in the absence of anti-IL-12 (Fig. 3A) were lower than those in a T+APC fraction stimulated in the presence of exogenous rIL-12 (Fig. 3B). The results suggest that a modest amount of IL-12 is produced by APC upon TCR stimulation of a T+APC population as previously shown 20 and induces detectable albeit slight levels of CCR5 expression on TCR-triggered T cells. Together with the results of Fig. 2, these observations show an important role for IL-12 in the induction of CCR5 expression on T cells.

2.2 IL-12-induced CCR5 induction is IFN-γ  independent

IFN-γ is produced following stimulation of TCR-triggered T cells with IL-12 21. We determined whether CCR5 expression is induced via the effect of IFN-γ produced as a result of IL-12 stimulation or directly via an IL-12 signal. TCR-triggered T cells were exposed to IL-12 in the presence of anti-IFN-γ mAb for the neutralization of IFN-γ produced in culture. Complete neutralization of IFN-γ in culture supernatant was confirmed by ELISA (data not shown). As shown in Fig. 4A, CCR5 induction was not influenced by neutralizing IFN-γ. Thus, IL-12-induced CCR5 expression is IFN-γ independent.

2.3 CCR5 is induced on both CD4⁺ and CD8⁺ T cell subsets

CCR5 has been shown to be induced on Th1 CD4⁺ T cells 15, 16, whereas only a few studies 22 have addressed the induction of CCR5 on CD8⁺ T cells. We examined whether exposure of TCR-triggered T cells to IL-12 induces CCR5 on both CD4⁺ and CD8⁺ T cells. Each CD4⁺ or CD8⁺ T cell population was separated from T cells exposed to IL-12 following TCR triggering. As shown in Fig. 4B, both CD4⁺ and CD8⁺ T cells expressed CCR5 mRNA. Thus, IL-12-induced CCR5 expression occurs in recently activated T cells irrespective of their phenotypes.

2.4 IL-12 induction of chemokine receptor is selective to CCR5

CXCR3 is expressed on Th1 T cells along with CCR5 expression 15, 16. We determined whether CXCR3 is also up-regulated by exposure to IL-12 (Fig. 5, left panel). This was examined in comparison with CCR5 and another control chemokine receptor CCR1. Anti-CD3/anti-CD28-stimulated T cells expressed negligible levels of CXCR3 mRNA. However, when these T cells were recultured free of stimulating reagents, high levels of CXCR3 expression were observed. While this CXCR3 expression was somewhat down-regulated in the presence of rIL-2, rIL-12 did not influence the levels of CXCR3 expression. Portions of the same RNA samples were examined for CCR5 and CCR1 expression. The pattern of CCR5 expression was essentially the same as shown in Fig. 2A. CCR1 was not induced in T cells following TCR/IL-12 stimulation, although unfractionated spleen cells including macrophages expressed CCR1 mRNA (data not shown). Thus, CCR5 is a chemokine receptor induced selectively in TCR-triggered T cells by exposure to IL-12.

2.5 The induction of CCR5-reactive chemokines in TCR-triggered T cells before and after IL-12 exposure

CCR5 is a chemokine receptor reactive to MIP-1α, MIP-1β and RANTES 9. We also examined whether these three chemokines are induced in TCR-triggered/IL-12-exposed T cells in parallel to CCR5 induction (Fig. 5, right panel). MIP-1α and MIP-1β mRNA were detected in TCR/CD28-triggered T cells and rapidly disappeared in the subsequent culture without stimulating antibody irrespective of whether these T cells were exposed to IL-12 or IL-2. RANTES mRNA expression was induced in TCR-triggered T cells when they were recultured, and was not enhanced by cytokine exposure but rather slightly or markedly down-regulated in the presence of IL-12 or IL-2, respectively. Thus, CCR5-reactive chemokine induction was achieved by TCR triggering but not by IL-12 exposure. It should be noted that the induction of the CCR5 chemokine receptor and CCR5-reactive chemokines do not synchronize in recently activated T cells.

2.6 Surface expression of CCR5 on TCR-triggered T cells after exposure to IL-12

We examined surface CCR5 expression by staining IL-12-stimulated T cells directly with anti-mouse CCR5 mAb. Stimulation of TCR-triggered T cells with IL-12 but not with IL-2 increased the incidence of CCR5-positive cells in the whole (CD4 plus CD8) T cell population (Fig. 6A). We further compared CCR5 expression between CD4 and CD8 T cell subsets and between naive and memory T cells. CCR5⁺ cells were induced in both CD4⁺ and CD8⁺ T cell subsets (Fig. 6B), but the incidence of CCR5⁺ cells was higher in the CD8 than the CD4 subsets. The results of Fig. 7 show that CCR5 induction occurred in both CD62L⁺ (naive) and CD62L^– (memory) phenotypes of T cells, although the incidence in the latter is higher than that of the former.

2.7 Induction of Ca²⁺ mobilization by stimulation with a CCR5-reactive chemokine MIP-1α in IL-12-stimulated T cells following TCR triggering

To confirm that CCR5 expressed on the surface of IL-12-stimulated T cells is a functional receptor, we examined whether a CCR5-reactive chemokine, MIP-1α, induces Ca²⁺ mobilization as a result of surface CCR5 stimulation. Fig. 8 shows that stimulation with MIP-1α resulted in high levels of Ca²⁺ influx in IL-12-stimulated T cells following TCR triggering. This contrasted with low levels of Ca²⁺ influx in IL-2-stimulated T cells. Together, the results of Fig. 6 and 8 indicate that stimulation of TCR-triggered T cells with IL-12 results in the surface expression of CCR5 and that such CCR5 reacts with the relevant chemokines and works as a functional receptor.

4.1 Mice

BALB/c mice were purchased from Shizuoka Laboratory Animal Center, Hamamatsu, Japan and used at 7–9 weeks of age.

4.2 Reagents

Mouse rIL-12 was provided by Genetics Institute, Inc. (Cambridge, MA). Mouse rIL-2 was kindly provided by Shionogi Co. (Osaka, Japan). Anti-CD3 (145–2C11) 32, anti-CD28 (Pv-1) 33, anti-I-A^d/b (34-5-3S) 34, anti-mouse IL-12 (C17.8) 35 and anti-IFN-γ (R4–6A2) (American Type Culture Collection, Bethesda, MD) mAb were purified from culture supernatants or ascites fluid of respective hybridomas. Mouse MIP-1α was purchased from R & D Systems (Minneapolis, MN). Allophycocyanin-conjugated anti-CD8 or anti-CD4 (PharMingen, San Diego, CA), and phycoerythrin (PE)-conjugated anti-mouse CCR5 mAb (PharMingen, Cat. no. 559923) were also obtained.

4.3 Preparation of various T cell populations

Lymph node or spleen cells were depleted of B cells and Ia⁺ APC by immunomagnetic negative selection as described 21. Cells were allowed to react with anti-I-A^d/b mAb and then incubated with advanced magnetic particles bound to goat anti-mouse Ig (Advanced Magnetic, Cambridge, MA). A T cell population depleted of anti-I-A^d/b-labeled and/or surface Ig⁺ cells was obtained by removing cell-bound magnetic particles with a rare earth magnet (Advanced Magnetic). CD4⁺ or CD8⁺ T cells were further depleted by incubating this population with anti-CD8 or anti-CD4 mAb followed by magnetic particles conjugated to goat anti-rat IgG (Advanced Magnetic). Purity of the resulting population was checked by flow cytometry.The purity was consistently >97% for the whole (CD4 plus CD8) T cell population and >95% for either CD4 or CD8 population. In some experiments, a population depleted of B cells alone was prepared and used as a T + APC population. To obtain CD62L⁺ and CD62L^– cells, purified T cells were labeled with superparamagnetic microbeads conjugating anti-CD62L mAb (Miltenyi Biotec, Sunnyvale, CA). Labeled cells were separated from unlabeled cells by magnetic cell sorting using the MiniMACS (Miltenyi Biotec). The magnetically labeled cells were retained in a MiniMACS column inserted into a MiniMACS magnet, while the unlabeled cells passed through. Labeled cells were eluted after the column was removed from the magnet. The cells that passed though the column and those elutedfrom the column were used as CD62L^– and CD62L⁺ T cell populations, respectively.

4.4 Stimulation of T cells with anti-CD3 plus anti-CD28 mAb

Anti-CD3 (5 μg/ml) was immobilized to individual wells of 24-well culture plates (Corning 25820, Corning Glass Works, Corning, NY) in a volume of 0.5 ml. After 3 h, solutions were discarded and plates were washed twice with PBS. Purified T cells were cultured in 2 ml RPMI 1640 medium supplemented with 10% fetal bovine serum and 2-mercaptoethanol (2-ME) at 1.5×10⁶ cells/well in the presence of 2 μg/ml soluble anti-CD28 mAb for 48 h in a CO₂ incubator.

4.5 Immunofluorescence and flow cytometry

CCR5 was stained using PE-conjugated anti-CCR5 mAb. Activated T cells were stained with anti-CCR5 mAb together with anti-CD4 and/or anti-CD8. CCR5 expression was detected on cells stained withanti-CD4 plus anti-CD8 or on cells stained with either anti-CD4 or anti-CD8 and then gated on a CD4⁺ or CD8⁺ T cell population. Stained cells were analyzed with a FACSCalibur (Becton Dickinson, Mountain View, CA).

4.6 cDNA probes

CCR5, CXCR3 and RANTES cDNA were cloned from purified mouse lymph node cells that were activated for 48 h with immobilized anti-CD3 (5 μg/ml) and soluble anti-CD28 (2 μg/ml) in the presence of 250 pg/ml mouse rIL-12. CCR1 cDNA was cloned from unfractionated spleen cells that were treated for 48 h with 5 μg/ml concanavalin A, harvested and then restimulated for 48 h with 100 U/ml mouse rIL-2 (Shionogi Pharmaceutical Co.). MIP-1α and MIP-1β cDNA were cloned from cells of the mouse macrophage cell line RAW 264 that were treated for 12 h with 100 pg/ml LPS (Escherichia coli 1027:B8; Difco Laboratories). RNA isolated from the above cells were used as templates for first-strand cDNA synthesis. The mouse CCR5, CCR1, CXCR3, MIP-1α, MIP-1β and RANTES coding sequences were cloned from these cDNA usingTaq DNA polymerase, standard PCR conditions and the following primers: CCR5, a 5′ sense oligonucleotide GGATTTTCAAGGGTCAGTTC and a 3prime; anti-sense oligonucleotide AACCTTCTTTCTGAGATCTGG based on sequences 77–96 and 580–600, respectively, from the sequence of CCR5 36; CCR1, a 5′ sense oligonucleotide ATGGAGATTTCAGATTTCACAG anda 3prime; anti-sense oligonucleotide TCAGAAGCCAGCAGAGAG based on sequences 1–22 and 1051–1068, respectively, from the sequence of CCR1 37; CXCR3, a 5′ sense oligonucleotide GCTAGATGCCTCGGACTTTG and a 3prime; anti-sense oligonucleotide GCTGATCGTAGTTGGCTGATA based on se-quences 30–49 and 566–589, respectively, from the sequence of CXCR3 38; MIP-1α, a 5′ sense oligonucleotide TGACACTCTGCAACCAAGTC and a 3prime; anti-sense oligonucleotide GAACGTGTCCTGAAGTCTTTC based on sequences 114–133 and 589–609, respectively, from the sequence of MIP-1α 39; MIP-1β, a 5′ sense oligonucleotide TGGATTACTATGAGACCAGCA and a 3prime; anti-sense oligonucleotide CAGTCATATCCACAATAGCAGA based on sequences 208–228 and 574–595, respectively, from the sequence of MIP-1β 40; and RANTES, a 5′ sense oligonucleotide AGCTGCCCTCACCATCATC and a 3prime; anti-sense oligonucleotide GTATTCTTGAACCCACTTCTTC based on sequences 54–72 and 270–291, respectively, from the sequence of RANTES 41. The PCR products were purified by agarose gel electrophoresis and ligated to the T-vector as described 42. Briefly, Bluescript (Stratagene, La Jolla, CA) plasmid was digested with EcoRV and incubated with Taq polymerase with the use of standard buffer conditions in the presence of 2 mM dTTP for 2 h at 70°C. After phenol extraction and precipitation, the T-vector was ready for cloning. PCR products were then ligated to the vector. cDNA for IL-12R β1 and β2 were cloned as previously described 43. cDNA for β2 microglobulin (β2M) was kindly provided by Dr. Takeshi Tokuhisa (Chiba University Medical School, Chiba, Japan).

4.7 Measurement of mRNA expression

Total cellular RNA was isolated by the acid guanidinium-thiocyanate-phenol-chloroform method and mRNA levels were determined using the RNase protection assay according to the procedure previously described 44. Briefly, 10 μg total cellular RNA was hybridized in solution to a ³²P-labeled anti-sense riboprobe for overnight at 50°C in 80% formamide. The plasmid was linearized with Hinf I (CCR5), Hinc II (CCR1), Hpa I (CXCR3), Ava II (MIP-1α), Bgl II (MIP-1β), Fok I (RANTES), Hind III (IL-12R β1) or Nde I (IL-12R β2) and an in vitro transcription was performed in the presence of [α-³²P]UTP. The protected fragment (172 bp for CCR5, 179 bp for CCR1, 279 bp for CXCR3, 216 bp for MIP-1α, 313 bp for MIP-1β , 232 bp for RANTES, 343 bp for IL-12R β1 or 235 bp for IL-12R β2) was separated on a denaturing sequencing gel. As an internal control for the amount of RNA loaded onto the gel, RNA was simultaneously hybridized to an anti-sense ³²P-labeled probe for the β2M gene (127 bp).

4.8 Calcium mobilization assay

T cells were suspended at 1×10⁷/ml in 2% FBS/PBS containing 3 μM fura-2AM (DOJINDO, Kumamoto, Japan) and incubated at 37°C for 30 min. Fura-2-loaded cells were pelleted and washed twice and then resuspended at 5×10⁶/ml in PBS containing 0.5 mM CaCl₂. The calcium response was initiated by addition of 1 nM MIP-1α. Cells were analyzed for free calcium ion by measurement of fura-2 fluorescence emission on fluorescence photometer HITACHI F-3000 (Tokyo, Japan).